NBD Company Number:36VN0107353343
The latest trade data of this company is 2022-07-29
VIETNAM Importer
Data Source:Customs Data
Records:469 Buyers:0 Suppliers:31
Related Product HS Code: 32151900 34021190 38220010 38220090 39261000 39269099 48219090 84719010 90278030 90318090 96082000 96121090
Related Trading Partners: R-BIOPHARM NEDERLAND B.V. , HIMEDIA LABORATORIES PVT.LTD. , SALUS DISCOVERY LLC MORE
SURAN.,JSC was included in the global trader database of NBD Trade Data on 2021-05-14. It is the first time for SURAN.,JSC to appear in the customs data of the VIETNAM,and at present, NBD Customs Data system has included 469 customs import and export records related to it, and among the trade partners of SURAN.,JSC, 0 procurers and 31 suppliers have been included in NBD Trade Data.
| Year | Import/Export | Partner Count | Category Count | Region Count | Entries Total | Total Value |
|---|---|---|---|---|---|---|
| 2022 | Import | 18 | 9 | 10 | 144 | 0 |
| 2021 | Import | 21 | 17 | 12 | 325 | 0 |

Using NBD Trade Data can help the users comprehensively analyze the main trade regions of SURAN.,JSC , check the customs import and export records of this company in NBD Trade Data System till now, master the upstream and downstream procurers and suppliers of this company, find its new commodities procured or supplied, search the contact information of SURAN.,JSC and the procurement decision maker's E-mail address. NBD Trade Data System is updated once every three days. At present, the latest trade data of this company have been updated until 2022-07-29.
Recent customs import and export records of SURAN.,JSC are as follows:
| Date | Imp & Exp | HS CODE | Product Description | Country | Imp or Exp Company | Details |
|---|---|---|---|---|---|---|
| 2022-07-29 | Import | 38220090 | Hóa chất sử dụng cùng máy realtime PCR careGENE STD 12 Detection Kit, Model:MST-N10082, hãng sản xuất: Wells Bio, Inc., Korea (Republic), đóng gói 100 test/Bộ/hộp/Kit,dùng trong y tếHàng mới 100% | KOREA | W***. | More |
| 2022-07-20 | Import | 38220090 | Chất thử Oligo DNA tổng hợp đánh dấu huỳnh quang (Probe), tinh sạch HPLC, b-globin-P; -5' - HEX-TAGTGATGGCCTGGCTCACCTGG AC - BHQ-1'-3', đóng gói 0.2 umol/ống, dùng cho phòng thí nghiệm. mới 100% | SWITZERLAND | M***G | More |
| 2022-07-20 | Import | 38220090 | Chất thử Oligo DNA tổng hợp (Primer), loại muối, b-globin-F; GCAAAGGTGCCCTTGAGGT, đóng gói 0.2 umol/ống, dùng cho phòng thí nghiệm. Hàng mới 100%. Nhà sản xuất Microsynth AG. (Thụy Sỹ). | SWITZERLAND | M***G | More |
| 2022-07-20 | Import | 38220090 | Chất thử Oligo DNA tổng hợp (Primer), loại muối, DYS14-R; GCCCATCGGTCACTTACACTTC, đóng gói 0.2 umol/ống, dùng cho phòng thí nghiệm. Hàng mới 100%. Nhà sản xuất Microsynth AG. (Thụy Sỹ). | SWITZERLAND | M***G | More |
| 2022-07-20 | Import | 38220090 | Chất thử Oligo DNA tổng hợp (Primer), loại muối, TSPY-F; AGAGCGTCCCTGGCTTCTG, đóng gói 0.2 umol/ống, dùng cho phòng thí nghiệm. Hàng mới 100%. Nhà sản xuất Microsynth AG. (Thụy Sỹ). | SWITZERLAND | M***G | More |